Moon of the Day - Charon

Today's moon is Charon, the largest moon of the dwarf planet Pluto.

Charon is a little different from the other moons we've discussed so far, in that its classification is somewhat open to debate. That's because the center of mass, or barycenter, of Pluto and Charon actually lies in the space between the two bodies, which means that they essentially orbit each other (here's what an ordinary planet-moon system might look like -- the barycenter is inside the planet). So is it still a moon? Or a binary planet? Does it matter?

We'll get the first ever close-up images of the Plutonian system when the New Horizons spacecraft arrives in 2015. I can't wait.

Japan Announces 2020 Lunar Base... for robots.

The Japanese Aerospace Exploration Agency (JAXA) has announced plans to build a lunar base by 2020... for robots.

Beginning in 2015, the plan is to land large, mostly autonomous robots near the south pole of the moon and begin construction of an unmanned base. This would be the first time a complex structure is built on another world.

The robots will be equipped with tank-like treads, solar panels, seismographs, high-definition cameras, and arms to retrieve moon rock samples. Those samples will then be returned to the Earth via rocket.

This is a very ambitious project. But something tells me the Japanese know what they're doing when it comes to robots. I'm loving JAXA right now.

Obama Plan Faces More Congressional Criticism

President Obama's plan to scrap the Constellation program returning astronauts to the moon continues to face criticism on Capitol Hill.

As I've said before, I'm cautiously optimistic about the new plan, which funnels more money into robotic science missions, and aims to send astronauts to an asteroid in 2025 and to Mars a decade later. Ferrying astronauts to the International Space Station, meanwhile, would be handed over to the private sector.

This last part is probably the most contentious aspect of the new vision for NASA (more than abandoning a return to the Moon). So far it is not clear how exactly this will work... or at least, NASA and the administration have done an inadequate job of explaining to the public how this will work. What sort of government involvement will there be for these private launches? Will the government be in charge of mission control? Who will be training the astronauts? Will it be as safe, and will the technology really be ready in the next five years?

Of course, private industry has been building military aircraft for the government for many years, and no one is worried about Boeing or Lockheed having too much control over what our pilots fly, or whether we can trust private industry to make an aircraft safe. We ask them to build something, we take bids and they build it. And it seems to work out pretty well, for the most part.

If this is what the President has in mind, we probably shouldn't worry too much about it. If it can bring down some of the costs of space travel (by making the industry more competitive), that's a great step forward, especially since budget woes have always been one of the most serious obstacles for NASA's progress. But the answers, so far, have been unsatisfactory, and Congress is going to need more information before they sign on.

Red Bull Supersonic Freefall

This summer, Austrian daredevil Felix Baumgartner will be jumping from a helium balloon 23 miles above the surface of the Earth.

This is just a spectacular feat that Felix is attempting. Jumps like this have been attempted only a few times, in 1959 and 1960. And he'll break the sound barrier by diving from this altitude.

Space travel is an incredibly perilous endeavor, as we know all too well from the Challenger and Columbia disasters. But that's what makes this jump, and the last of its kind in 1960, so extraordinary. There is no ship, no heat shield between his spacesuit and his inhospitable surroundings -- a place where blood boils at body temperature. It's just a man against the elements.

I can't wait to see it.

X-51 hypersonic test flight success

The X-51 WaveRider was successfully launched today from the wing of a B-52 Stratofortress, flew for approximately 200 seconds and reached Mach 6, as expected.

Program Manager Charlie Brink was quoted as saying, "We equate this leap in engine technology as equivalent to the post-World War II jump from propeller-driven aircraft to jet engines."

Planet Simulator

I spent hours playing with this planet simulator when I first discovered it. Check it out.

Here's a fun challenge: make your own moon!

You'll need to put a planet (Size L) in orbit around the star... make sure you select circle. Then, take a small object (Size S) and fire it just so to get it going around the planet (think of it as a captured satellite). It takes some experimenting, but with a little practice I was able to get two or three going around the planet at the same time. It's tough to keep the orbits stable, though. After a while you're bound to have at least one of them ejected. Extra points if you can eliminate the eccentricity.

You can also try to replicate the inner solar system (from Mercury to Jupiter). The only problem is, even when you zoom out there isn't adequate space to give the planets an appropriately wide berth for their gravity wells. But it's close enough... just make sure you use small objects for all the terrestrials. Otherwise they'll pull on each other too much.

Don't forget the asteroid belt! And if you add some small objects around Jupiter's orbit, you might get to see some Trojans coalesce at the Lagrangian Points.

If you drop in a few large objects, and clutter it with lots of small objects (which can serve as analogy to the protoplanetary disk), you'll see that most of the small bodies are ejected, or drawn into the sun or planets. It's a marvelous illustration of the simplicity of physics and its capacity to leave us with the graceful solar system we see today.

Would you say I have a plethora of new asteroid discoveries?

The Jet Propulsion Laboratory reports that their WISE (Wide-field Infrared Survey Explorer) spacecraft has discovered about 11,000 asteroids since its activation in January, 2010. That works out to about 100 a day. 50 of those are near-Earth objects.

JPL explains why infrared is great for finding asteroids:

With its infrared vision, WISE is good at many aspects of asteroid watching. First, infrared light gives a better estimate of an asteroid's size. Imagine a light, shiny rock lying next to a bigger, dark one in the sunshine. From far away, the rocks might look about the same size. That's because they reflect about the same amount of visible sunlight. But, if you pointed an infrared camera at them, you could tell the dark one is bigger. Infrared light is related to the heat radiated from the rock itself, which, in turn, is related to its size.

A second benefit of infrared is the ability to see darker asteroids. Some asteroids are blacker than coal and barely reflect any visible light. WISE can see their infrared glow. The mission isn't necessarily hunting down dark asteroids in hiding, but collecting a sample of all different types. Like a geologist collecting everything from pumice to quartz, WISE is capturing the diversity of cosmic rocks in our solar neighborhood.

Blog of Note!

Thanks to everyone who has visited and subscribed! I hope you enjoy it.

X-51 test rescheduled for today

The test for the X-51 WaveRider was postponed yesterday when a surface vessel crossed into the splashdown zone. The test has been rescheduled for today.

The scramjet is a fascinating technology, capable of achieving incredible sub-orbital speeds by avoiding some of the problems encountered by conventional jet engines at high velocity. Interestingly, though, the physics of the scramjet rely on traveling at a high speed, which means that there is a minimum velocity at which it can operate. To overcome this, the scramjet is carried aloft by an aircraft (a B-52, in this case), launched on the front of a rocket booster, and then engaged only when it achieves a speed around Mach 4.5 . This complicated procedure has led some critics to question the feasibility of its application in the real world.

Stay tuned for updates.

Moon of the Day - Ganymede

Today's moon is Ganymede, the last of Jupiter's four Galilean satellites.

Ganymede is the largest moon in the Solar System, and is the only moon to have a magnetosphere. It also has a tenuous oxygen atmosphere, and is believed to have an underground ocean of saltwater, buried some 200 kilometers beneath the surface.

Atlantis Returns

The Space Shuttle Atlantis touched down this morning, probably for the last time. The shuttle will be retired after flying over 120 million miles in space.

Welcome home, and job well done.

SpillCam

Live feed from the bottom of the Gulf of Mexico.

The Perils of Misinformation

Troubling news: The New York Times reports that climate change skeptics in Britain are winning the public opinion battle. This matches a trend seen in the United States, and elsewhere.

Anecdotal evidence can have a strong influence on the uninformed.

In case you missed it, read my Questions for Climate Change Skeptics.

The Union of Concerned Scientists offers this write-up on certainty vs. uncertainty in science:

In this culture of transparency where climate scientists describe degrees of certainty and confidence in their findings, climate change deniers have linked less than complete certainty with not knowing anything. The truth is, scientists know a great deal about climate change. We have learned, for example, that the burning of fossil fuels and the clearing of forests release carbon dioxide (CO2) into the atmosphere. There is no uncertainty about this. We have learned that carbon dioxide and other greenhouse gases in the atmosphere trap heat through the greenhouse effect. Again, there is no uncertainty about this. Earth is warming because these gasses are being released faster than they can be absorbed by natural processes. It is very likely (greater than 90 percent probability) that human activities are the main reason for the world's temperature increase in the past 50 years.

Message in a Base Pair

More news on J. Craig Venter's synthetic cell: the watermark DNA sequences are coded messages.

In creating the bacterium's DNA from scratch, the scientists added additional "watermark" base pair sequences to identify the cell as synthetic (i.e., not carrying the DNA of any natural organism). And it turns out, those sequences are words and messages. For instance:

CRAIGVENTER is coded as:
TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA

VENTERINSTITVTE is coded as:
TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAG TTAACTAGCTAA

HAMSMITH is coded as: TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA

CINDIANDCLYDE is coded as: TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTA GCTAATGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGT CGCCCTAAAACAAAGTTAAACATCATG

GLASSANDCLYDE is coded as:
TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA

But this isn't just genetic tom-foolery; the sequences demonstrate that the DNA strand really was assembled completely from scratch.

DIY Scale Model of the Solar System

Chances are, you don't have the time, the space, the resources, the patience, or an adequate level of geekdom to build a real scale model of the solar system. But don't you wish you did have all those things?

This little calculator gives you a great sense of relative sizes and distances of bodies in the solar system. Unfortunately, you can only start with an adjusted size for the Sun and calculate everything according to that. But it's still cool.

So, if you wanted your scale model Sun to be 3 feet across, your scale model Earth would be about 0.3 inches in diameter, and would have to be positioned 322 feet away. Pluto would sit over 2 miles away.

When I started working in my office a few years ago, we were in the habit of making rubber band balls. So I made two of them into a scale model of the Earth and Moon, and positioned them at the appropriate distance on the opposite sides of my desk. That elicited some weird looks, so maybe you want to do this at home.

Moon of the Day - Deimos

Today's moon is Deimos, the outer moon of Mars.

Like Phobos, Deimos' origin is still a matter of debate. Since its composition is similar to carbonaceous asteroids, it would seem logical that it could have been captured from the main belt. But there would have to be some mechanism for circularizing its orbit. Mars' atmosphere is too thin for atmospheric braking. But tidal forces, or perhaps the ejection of one or several other bodies, could have eliminated the eccentricity.

The Empire Strikes Back (1950)

What would it be like if The Empire Strikes Back were made 30 years earlier? Let's find out:

X-51 WaveRider test tomorrow

The Air Force is giving the X-51 WaveRider a 5-minute test flight tomorrow, during which the craft is expected to reach Mach 6 (or a little over 4,600 miles per hour).

The WaveRider is a wingless scramjet. So how does it stay aloft, you say? It rides its own shockwave.

Living in the Future, part 4: Holographic Broadcast for the 2022 World Cup

Japan wants to host the 2022 World Cup, and as part of their bid they are offering to broadcast live, full-scale 3D holographic games on fields around the world.

Of course, who knows if the technology will be available to accomplish such an incredible feat. But don't discount the world's appetite for innovative World Cup coverage. Afterall, the first live 3D broadcasts will be coming to us from South Africa this summer. And where there's a will, there's a way.

Moon of the Day - Io

Today's moon is Io, the innermost of Jupiter's four Galilean satellites.

Io is the most geologically active object in the solar system, with over 400 active volcanoes. These volcanoes spew sulfur and sulfur dioxide hundreds of kilometers above the surface, and give Io its unusual coloration.

Questions for Climate Change Skeptics

Here's a big surprise: The National Research Council has released another report saying that climate change is, in fact, still really happening.

Here are a few questions for climate change skeptics:

1. Do you believe in the greenhouse effect? If not, why does your car get incredibly hot when it sits out in the sun?

2. Do you believe in chemistry? If not, how do homemade volcanoes work?

3. If you believe in chemistry, do you believe that burning fossil fuels creates carbon dioxide? IF not, how do you know that? Let's see some proof. Peer-reviewed articles would be nice.

4. Also, If you believe in chemistry, do you believe that increased levels of carbon dioxide in the atmosphere leads to a more powerful greenhouse effect? If not, I'll need to see some more paperwork to back that up.

5. Do you believe that humans are capable of devastating the environment? If not, how do you explain the depletion of the ozone layer? (side question: do you know why we need an ozone layer?) And what do you make of the calamitous oil spill in the Gulf of Mexico?

6. In short, do you believe in science?

This last question is very important because science is all around us. The lights you switch on, the computer you use, the radio you listen to, the television you watch, the car you drive, the airplane you fly in, the paper you write on... none of these would be possible without science (well, obviously). These inventions rely on hundreds if not thousands of discoveries, big and small, made over the ages. Before we could invent a television, we needed to know about electricity, radio waves, the behavior of light, glass making, etc. But the same scientific method that brings us these dazzling inventions also tells us about how we're poisoning the planet.

So how can you enjoy the benefits of science and simultaneously demean its methods? Because when you deny human-driven climate change, that's what you're doing. You're calling into question the validity of thousands of detailed studies in all sorts of fields (chemistry, physics, atmospheric studies, oceanography) that you probably know next to nothing about. And your ammunition is pitifully insufficient. You're reduced to blaming it all on some vast left-wing conspiracy.

There is not enough time on a news broadcast, or in a single article, to go over the thousands of pages of evidence that support the theory of climate change caused by humans. So instead, the stories are distilled down to "this scientist says this, but this right-wing conspiracy theory group disagrees". And even though journalists are supposed to tell us all sides of the story, there really is just not equal footing for these two arguments. Just because you haven't seen all the proof for climate change, doesn't mean it's not really there. You're probably just not reading a lot of science journals.

This pattern of denying science on the most ludicrous terms goes beyond climate change, of course. I'll devote another column sometime to debunking the beliefs of Young-Earth Creationists.

It's infuriating when I hear fundamentalist Christians argue that every word of the Bible must be considered the literal truth, if you're to believe in any of it. So by the same token, scientists and science advocates like myself must be careful not to couch science in the same counterproductive dogma. But remember: you can always argue with a scientific theory. You're just going to need some evidence. And Sarah Palin's opinion doesn't count.

Moon of the Day - Titania

Today's Moon is Titania, the largest moon of Uranus.

Uranus and Neptune have only been visited once, by the Voyager 2 spacecraft (and, heartbreakingly, there are no plans to return anytime soon). As a result, we know comparatively little about their moons. Only about 40% of Titania's surface has been observed close-up, and the closest Voyager 2 ever came to Titania was 365,200 km... yielding a maximum spatial resolution of 3.4 km. We will have to wait many more years to improve on the few tantalizing images we've captured from the depths of the solar system.

Live Coverage of the IKAROS Launch

The Japanese Aerospace Exploration Agency (JAXA) will be launching the solar sail spacecraft IKAROS in about two hours. Watch live coverage of the launch here.

Here's a little more information on the mission.

A Disquieting and Awesome Prospect.

 
Scientists at the J. Craig Venter Institute have apparently produced the first synthetic cell.

The chromosome they assembled has a special "watermark" sequence of base pairs to identify it as synthetic. And after the DNA strand was injected into a bacterium, that cell made copies of itself and the first cells descended from a computer were born.

According to Popular Science:

The researchers are already planning to create a specially engineered algae designed to trap carbon dioxide and convert it to biofuel. Other applications could include medicine, environmental cleanup, and energy production.

While there may be many beneficial applications for this technology in the future, it could also open the door to producing DNA sequences of terrible consequence... a super disease, for instance. We must be cautious.

The New York Times has additional details.

Prince of Tides

Inventor W. Scott Anderson has designed a new tidal turbine to generate electricity... one that doesn't adversely affect marine life.

Tidal power is an under-recognized clean energy source. It's not currently a cost competitive technology, but that will probably change over time. And since the tides are always ebbing and flowing, the energy source is more consistent than the wind.

This guy looks pretty rugged.

Living in the Future, part 3

These two guys over at MIT are developing a cool new motion tracking interface for computers.

Using only a single webcam and brightly colored Lycra gloves, the user can see his or her hands appear on the screen almost instantly, and are able to manipulate objects in a virtual 3D environment.

Motion tracking technology has been in use for a while, but nothing so far has been this cheap and user-friendly.

Moon of the Day - Europa

Today's moon is Europa, the smallest of Jupiter's four Galilean satellites.

Europa is another very important moon in the search for extraterrestrial life. That's because its fractured, icy surface sits on top of an ocean of liquid water, which scientists believe could be 100 kilometers deep. Since life on Earth arose out of the oceans, an ocean of liquid water on another world is a great place to start looking. Of course, getting to that ocean presents a problem: the icy surface is several kilometers thick.

Red Bull Gives You Wings... or a Parachute.

Red Bull is sponsoring a sky dive from a balloon 23 miles high, which aims to get this gentleman, Austrian madman Felix Baumgartner, to break the speed of sound.

This jump will also break the record for the highest parachute jump, set by Captain Joe Kittinger in 1960. Kittinger jumped from 102,800 feet (about 19.4 miles), and reached a top speed of 614 mph.

Looking forward to watching it, Felix. That's an awesome name, by the way.

Learning How To Stay Sane on a Trip to Mars

Russia is sealing these guys up for 520 days on a simulated mission to Mars. Last year four men participated in a similar experiment, lasting 105 days.

Long distance space travel poses several challenges. Radiation poisoning is a serious hazard. Zero gravity causes many health problems. And of course rescue could be impossible if there were to be a major malfunction on the craft.

Cabin fever could also take a psychological toll on the crew, so it's crucial that we learn what sorts of other issues may arise from this isolation before setting out on the real voyage... even though that voyage may be 20 or 30 years away. This simulation seeks to answer some of those questions.

Good luck, fellas.

Utopian Highways

 


I love futuristic city concepts. They usually don't amount to anything, but occasionally they do.

It's fun to imagine novel concepts put into action, like the bike lanes in the sky. And sometimes creative re-imaginings of abandoned spaces do get built, and turn out to be really cool. And then there are some concepts that, while cool, are somewhat ill-conceived.

Here's a little collection of creative city concepts from decades past, courtesy of Popular Science.

Living in the Future, part 2

Israeli programmers are working on an algorithm that can recognize sarcasm. So far it's 77% accurate.

I can't wait for my computer to start making fun of me.

Moon of the Day - Hyperion

Today's moon is Hyperion, a moon of Saturn.

This is the second irregularly shaped moon we've featured. But this one is much larger than Phobos, with a mean radius of approximately 135 km (compare to Phobos' 11.1 km). Hyperion has, as you can see, a very unusual sponge-like surface, and is unique among moons in the solar system for its chaotic axial rotation.

Take a look at this spectacular full-size version.

Searching for Life on Mars, redux.

The Associated Press is reporting that NASA is working with the European Space Agency to plan a new mission to Mars, one that will return soil samples to the Earth to look for signs of life.

This will be the first attempt since 1976 (with the Viking missions) to test directly for life on Mars (past or present).

Fermilab matters.

Fermilab has used it's Tevatron particle collider to solve another piece of the puzzle.

In smashing together protons and antiprotons, Fermilab has found that the resulting particles from the collision consist of about 1 percent more matter than antimatter. This could explain why we see an abundance of matter in the Universe, and very little antimatter. And it also gives clues as to why we exist at all... if there had been equal amounts of matter and antimatter at the time of the Big Bang, everything would have been annihilated and there would be nothing left. As it happens, though, even with just a 1 percent advantage, matter soon becomes king of the castle.

Map of the Spill

The New York Times is providing this interactive feature tracking the growth and movements of the oil spill in the Gulf of Mexico.

Cassini two-for-one special

Cassini will fly by Enceladus and Titan this week, without having to do any special maneuvering. Those guys at JPL really are top drawer.

Read more about the science objectives here.

Moon of the Day - Phobos

Today's Moon is Phobos, one of the two small moons of Mars.

Phobos is the first moon we've featured with an irregular shape. Since it is a very small moon (with a mean radius of only 11.1 km), there is insufficient gravity to pull it into a sphere. This also means that the escape velocity is very low: only about 40 km/h (compare with Earth's 40,269 km/h escape velocity). Since its composition and density have much in common with C-Type asteroids, many astronomers believe that Phobos and Deimos are captured from the main belt between the orbits of Mars and Jupiter. But this theory is not entirely proven, as there is so far no definitive explanation for the circularizing of their orbits.

Take a look at this incredible full size version of the picture above, courtesy of the Mars Reconnaissance Orbiter.

JAXA launch delayed

The Japanese Aerospace Exploration Agency has postponed the launch of the Venus Climate Orbiter "AKATSUKI" (The Solar Sail Spacecraft) due to inclement weather. The launch has been rescheduled for 6:58:22 am (JST) on Friday, May 21st.

For those of you who don't tune in to NASA TV.

The launch of a space vehicle, to me, makes for riveting television. It's an elegant demonstration of our magnificent achievements as a species.

NASA launches can be delayed sometimes for many days, so it's hard to know for sure if you can be around for one. But I would just love to get down to Florida to catch one of the last two flights of the shuttle. It's going to be the last of that kind of spectacle for a long time, and for the shuttle, the end of an era.

Make sure you watch around the 9:00 minute mark. The separation from the external fuel tank is incredible. But you should really just watch the whole thing.

A Brief History of Spacesuits

NASA rolls out this interactive feature (complete with Sims-esque animation) on the history of American spacesuits.

Swim Aside, Speed Your Ride

Old New York City subway cars are used to make artificial reefs. Check out what it's like when strap-hangers are replaced by sea turtles:

Death Rattle

Until Congress officially terminates the Constellation program, NASA has to keep working as though it's still on. And perhaps in an effort to demonstrate the project's viability and keep it alive, they've accelerated development, bumping up the first manned launch of the Ares I rocket to November 2014.

President Obama has proposed that development of the Orion capsule, designed to sit atop the Ares I rocket, be continued to serve as a lifeboat for astronauts on the International Space Station. Critics have argued that using Orion in that capacity is an enormous waste of money.

Pictured here, the Ares I-X test vehicle, which flew on October 28, 2009.

Moon of the Day - Triton

Today's moon is Triton, the largest moon of Neptune.

Triton (not to be confused with Titan) is another favorite of mine. It has a retrograde orbit which, in addition to its composition, has led astronomers to believe that it was once a Kuiper Belt object that was captured by Neptune. As we mentioned earlier, it is one of the few moons that has been observed to be geologically active, with geysers spewing liquid nitrogen.

Triton was discovered in October 1846, only 17 days after the discovery of Neptune.

Fin.

Space Shuttle Atlantis rockets into space on its last scheduled mission. Here's wishing them a safe and happy voyage.

Check out the details of their mission, STS-132.

Moon of the Day - Titan

Today's moon is Titan, the largest moon of Saturn.

Titan is just a fabulous moon. It's 50% larger than Earth's Moon, and larger than Mercury. It also has a dense atmosphere and is, so far as we know, the only other object in the solar system (besides the Earth) that has stable bodies of surface liquid. Of course Titan is much colder than the Earth, so the surface liquid isn't water... it's liquid hydrocarbons.

It's a great place to look for extraterrestrial life, as the environment is rich in organic molecules. And we've landed the Huygens probe there. Here's a picture from the surface →

Titan also plays an important role in the orbital mechanics used on the Cassini mission. Read all about how the guys at the Jet Propulsion Laboratory are extending the mission another seven years on only 22% fuel capacity in this fascinating New York Times article.

Neil and Gene add their two cents.

Apollo astronauts Neil Armstrong and Gene Cernan tell Congress they don't like Obama's plan for NASA.

See the whole hearing here.

LEGO Star Wars

I see you have constructed a new playset.

Satellite Traffic

Sounds like it's getting pretty crowded up there. And we're flying blind. Physorg.com explains.

Here's an illustration of the situation (although the craft sizes have been exaggerated for effect).

Stumbling Into Space, revisited.

Timothy Ferris explores the history of the space shuttle's shortcomings and NASA's safety failures, and discusses the future of manned spaceflight in this great article from 2004.

Writing shortly after the Columbia disaster, Ferris critiques the Bush administration's plan for a return to the moon, and argues that we must be able to make some money from our space endeavors if we're to accomplish more ambitious goals. But this almost certainly means that the private sector has to get involved in some way.

He also talks a little bit about building a space elevator, which would be awesome.

As we're facing yet another crossroads for human spaceflight, and deciding the fate of the Constellation program, this a good primer for that debate. And it would seem to lend some credibility to the President's proposal.

Moon of the Day - Callisto

Today's moon is Callisto, the outermost of Jupiter's Galilean moons. One of my favorites. Just look at it.

Parkour is amazing.

Damien Walters demonstrates.

Sailing to Venus

The Japanese Aerospace Exploration Agency, JAXA, is sending a solar sail spacecraft to Venus.

Rather than using struts to keep the sail taut, IKAROS (a great acronym, by the way... up there with C.O.L.B.E.R.T.) uses centripetal force to unfurl and keep the sail open. What a wonderful solution.

Solar sails use the force of photons emitted from the sun to propel a spacecraft and, since there is no friction and a continuous stream of particles, it can just accelerate and accelerate and accelerate. And the sail itself is exquisitely thin.

I'm loving JAXA right now.

More Budget Issues for NASA

The Times documents NASA's decline in basic research, due to budgetary woes.

It's always hard finding money for science. NASA usually seems to garner some bipartisan support, but the money is always a little below what is needed to really get things moving.

More generally, what really frustrates me are the budget hawks (like Senator John McCain, for instance... though there are certainly others) who delight in finding some obscure, crazy-sounding science project earmark to ridicule for political gain. It's irritating because science is a vast ocean of knowledge, slowly accumulated over the ages through small breakthroughs and painstaking work... the kind of work these scientists are usually doing. Of course debating the merits of a science project up for federal funds is legitimate, but the rhetoric often takes on that same old anti-intellectual tone, and lends credence to the notion that science is just the domain of ivory tower liberals who want to spend all of your money.

If we look at any of the major technical achievements of the 20th century, we can easily see that their development was only made possible by countless earlier discoveries. Television, for example, would not have been possible without first figuring out how to harness electricity, and manipulate radio waves. But the pioneers in those fields could not have had more than a dim notion that something like a television might be possible in the future. And such is the nature of today's discoveries. We can't possibly know what will be developed in the next 10, or 100 years. But they may very well rely on some silly-sounding experiment going on right now.

I wonder what Senator McCain would have said about Gregor Mendel, with those crazy experiments on pea plants. What's that got to do with us?!

Supermassive Projectile

An undergraduate student in The Netherlands, Marianne Heida, has discovered a supermassive black hole in the process of being ejected from its galaxy.

Wouldn't want to get in the way of one of those things.

Living in the Future

Technology is so seamlessly woven into our daily lives that it's easy to forget how amazing it is. It's only on those occasions when something breaks down that we get a glimpse of the technical underpinnings that make it all possible.

Take, for instance, the Galaxy 15 satellite, which has recently malfunctioned and may cause problems with cable television broadcasts. There's nothing particularly extraordinary about it, just another run-of-the-mill communications satellite in geostationary orbit. But did you know that it's sitting out there in space approximately 22,000 miles above the surface of the Earth? That's almost 1/10th the distance to the Moon. Of course it's not really sitting out there; it's zooming around in the [Arthur C.] Clarke Belt covering about 165,000 miles everyday. Just like all the other geostationary satellites.

These little robots are zipping around all over the sky, but they don't get any press. It's easy to take these things for granted.

Moon of the Day - Enceladus

Today's moon is Enceladus, a moon of Saturn.

Enceladus is one of only three bodies in the outer solar system where active eruptions have been observed (the other two are Jupiter's Io and Neptune's Triton). The geological activity is the result of tidal heating from Saturn's immense gravitational pull, and the cryovolcanism is thought to be the source of Saturn's diffuse E Ring.

Photo taken by Voyager 2 in August, 1981.

A Whale of a Tale (and it's all true, I swear by my tattoo)

Caught this great documentary on the history of American whaling this past Sunday night on PBS.

Set your DVR for American Experience, or watch it online.

Gold Record

The Voyagers are still talking to us.

It's amazing that we're still in contact with these spacecraft after 33 years. And if they remain unmolested by objects at the edge of the Solar System, they will continue to drift for eons longer in the vast empty space between the stars.

It's really great.

NASA at work

Here's NASA doing more stuff that looks like a lot of fun.

We'll be talking a lot about the future of NASA, of course. Personally, I'm sort of on the fence about Obama's plan for human spaceflight, but I'm cautiously optimistic. The program needs a jump-start, and it could be that getting the private sector involved is a necessary step for pushing ourselves to the next level. But I hope the expertise of NASA's employees is not lost in the transition.

In any case, going to an asteroid should be pretty cool.

Moon of the Day - Iapetus

Most people can name all the planets in the solar system. But there's a vast array of other worlds out there that you may never have even heard of, or know next to nothing about. So with that in mind, I will be selecting a Moon of the Day (when I remember). Eventually we'll move on to other astronomical objects.

Today's moon is Iapetus, a moon of Saturn. The moon is easily recognized by its stark two-tone coloration (here's the other side). Read more about it here.

Man-Made Enviromental Disasters

An interesting collection of man-made environmental disasters, courtesy of huffingtonpost.

The Door to Hell in Derweze, Turkmenistan is a classic example of a myopic solution. While it may have been better for the environment than just allowing the natural gas to leak, the Soviet scientists had no idea the fire would burn so long. It's been burning since 1971.

Let's hope we can find a better solution to the oil spill in the gulf.

Welcome!

Dear readers (all zero of you, at the time of this writing),

Welcome to Sagan's Brain. I hope you will find the material stimulating.

We'll be touching on science, politics, and anything else that's worth talking about (that's a short way of saying, I don't want to be boxed in by my thesis). There'll probably be some music and film reviews, or recommendations. And I'm really enjoying exploring New York City right now, so bear with me if I talk a little about that. Anything that's wonderful or important will probably get a mention.

I hope you'll join in on the conversation.